Read before use
1, data from excel, copy and paste data into the input frame
2, data from txt, must tab-seperated, copy and paste data into the input frame
3, specieal and non-English characters such as #, <, >, %, (, ), α are not friendly
4, use point as decimal separator, not comma. e.g. 3.14, not 3,14 as pi
Required
query sequences (fasta format)


target sequences (fasta format)

Optional
score (alignment threshold, positive, the bigger, the strigent)
energy (free energy threshold, negative, the smaller, the strigent):
Note: the default threshold of miRanda is score=140, energy=1, we change energy threshold into -1

miRNA-mRNA, miRNA-circRNA, miRNA-lncRNA interaction prediction by miRanda

Introduction
miRanda is an algorithm for the detection of potential microRNA target sites in genomic sequences. miRanda is an algorithm for the detection of potential microRNA target sites in genomic sequences. miRanda reads RNA sequences (such as microRNAs) from file1 and genomic DNA/RNA sequences from file2. One or more miRNA sequences from file1 are scanned against all sequences in file2 and potential target sites are reported. Potential target sites are identified using a two-step strategy. First a dynamic programming local alignment is carried out between the query miRNA sequence and the reference sequence. This alignment procedure scores based on sequence complementarity and not on sequence identity. In other words we look for A:U and G:C matches instead of A:A, G:G, etc. The G:U wobble bair is also permitted, but generally scores less than the more optimal matches. One or more miRNA sequences from file1 are scanned against all sequences in file2 and potential target sites are reported. Potential target sites are identified using a two-step strategy. First a dynamic programming local alignment is carried out between the query miRNA sequence and the reference sequence. This alignment procedure scores based on sequence complementarity and not on sequence identity. In other words we look for A:U and G:C matches instead of A:A, G:G, etc. The G:U wobble bair is also permitted, but generally scores less than the more optimal matches. Find source code in official website.
Input data instructions
1, miRNA sequence in fasta format.
2, target sequence (mRNA 3'UTR, lncRNA, circRNA) in fasta format.
In the output file, '|' means perfect match, ':' means G:U pair, ' ' means mismatch.
Reference
A.J. Enright, B. John, U. Gaul, T. Tuschl, C. Sander, D.S. Marks; (2003) MicroRNA targets in Drosophila; Genome Biology 5(1):R1.
miRNA sequence
>hsa-miR-27b
UUCACAGUGGCUAAGUUCUGC
Target sequence
>Bcl3
GACGGATGGGGGGGCAGACCCGGACTCATGAGGAGGGGCCTCCCTGCCCTGT
GGGGACCACTCTTCTGGAAACTGTGAGGACCTTGTTCTGCTTCCCCCCGCCC
AATCCTCGGGACCAGGTTTTGCACCAAGGCACATGCACATACTACTGAGCACA
GATCCTCCCAATCGCGCCCCTTGCCCAGGACTCTCAGCCCCCACTTAATCTCA
GGCACCCAGGTTCCCTGTCTGGAATCCACCAGATACTCAATTCTTTGAGTGGA
GGAACCAAAGGACAGCCAGCCTCTCCTCTGCCACCCTCCACCCTGAGGGACCC
AGAGAAACAGAGGGGTCTGGGAGGGCATTGATCACAGTGTAAATTATTAGGTT
TGGGTCAGATTTCTTTTGTAATAAACTATTTTTGTATCAT
Output

1) How to plot?
1, Put data in excel according to the example format.
2, Copy and paste into input frame.
3, Input pre-checking button to check input
4, After checking pass, select parameters, submit and download

2) How to cite?
9000+ papers in (Google Scholar)
Tang D, Chen M, Huang X, Zhang G, Zeng L, Zhang G, Wu S, Wang Y. SRplot: A free online platform for data visualization and graphing. PLoS One. 2023 Nov 9;18(11):e0294236. doi: 10.1371/journal.pone.0294236. PMID: 37943830.

3) FAQs